Are .CEL scripts deprecated?

[BrainDead]

Hank,

Just so you know about it, I've added to the "Discussion" page on the
Wikibook site.

Thanks.

[hank]

Just so you know about it, I've added to the "Discussion" page on the Wikibook site.

That page is on my wikibook watchlist, so it tells me whenever anyone makes a change. And if you were a registered wikibook user, it would tell me that the changes were yours. I took the liberty of editing your comments slightly to put them into separate sections with more informative titles. You can also check my response there. Thanks.

- Hank

[cpotting]

Meanwhile, I've made a start on a simple CELX scripting tutorial for the Celestia wikibook. Feel free to check it out.

- Hank

EXCELLENT work hank!!! It looks like your tutorial is off to a great start. BTW, are you a teacher? You seem to have a knack for this.

[BrainDead]

I absolutely agree with Bob.
I tried to understand the CELX "philosophy", but haven't been able to dive sufficiently deep to make me love .celx as I love .cel scripting way.

Andrea,

Have a look at the Wikibook site. I think you'll agree that this is a very nice
way to exchange educational material for even us Brain-Dead types.

Also - if I haven't made it clear yet - I'd just like to thank Hank again
for going to all of this trouble. Methinks I'm on to something here. I'm
actually learning CELX, albeit at the "Kindergarden" level.

[ANDREA]

[quote="BrainDead]Have a look at the Wikibook site. I think you'll agree that this is a very nice
way to exchange educational material for even us Brain-Dead types. [/quote]

I agree again with you, Bob, and it's what I'll do, even if I'm not used to programming.
But I still need some information on CELX, before starting my educational tour: is it worth for my needs?
I explain: CEL scripts allow me to stop, move, modify almost everything during the show., but CELX doesn't allow this, correct?
For my needs (shows for school boys aged 10-18, and for adults), when I receive a question, I need the possibility to stop, explain what they are asking for, show again, go closer or farther, speed-up or slow down, and so on.
If CELX makes this impossible, sorry, it's not for me.
Someone can inform me on this, please?
Thanks a lot.

Andrea

[hank]

Let me ask another way... If all I wish to do is tour the known universe, why do I need CELX?

Try out this.

- Hank

[hank]

But I still need some information on CELX, before starting my educational tour: is it worth for my needs?
I explain: CEL scripts allow me to stop, move, modify almost everything during the show., but CELX doesn't allow this, correct? 8O
For my needs (shows for school boys aged 10-18, and for adults), when I receive a question, I need the possibility to stop, explain what they are asking for, show again, go closer or farther, speed-up or slow down, and so on.
If CELX makes this impossible, sorry, it's not for me. :evil:
Someone can inform me on this, please?
Thanks a lot.

Andrea :D

Andrea,

I'm not sure what your exact requirements are, so there may be some restriction that would affect you. But you can pause CELX scripts with the space bar and then use the interactive controls to manipulate the view, etc. You might try some experiments to see whether CELX can do what you need. Long-term, if CELX won't do what you want, that needs to be fixed.

- Hank

[t00fri]

Well some time ago I found out accidentally that I speak /perfectly/ Lua. That's funny, since I never even had a close look at Lua. The discovery was that Lua is 99.9% identical to the programming language of the algebraic manipulation package Maple that I use almost /daily/ since > 15 years!

I never managed to find out why this resemblance was so close. There is nowhere any reference neither to Maple nor to Lua. ...

Back to the point:

Lua being much more powerful than cel scripts, I think there is room for both scripting languages.
Lua is definitely better for people being used to programming, while cel is much simpler and does a good job for many tasks nevertheless.


Bye Fridger

[hank]

It looks like your tutorial is off to a great start. BTW, are you a teacher? You seem to have a knack for this.

Just a humble computer programmer. Perhaps I should consider a career change?

- Hank

[BrainDead]

Try out this.

I have already downloaded and used every CELX script you've placed on this
forum.

This particular script just doesn't do anything for me though. I don't want
random encounters, I want specific encounters - along with feature highlights
and the pointing out of various interesting features.

Here's an example of what I have in mind... Go to the nearest (or farthest)
black hole you can think of, and show me what cool things it does. Jets?
Material being sucked into the center mass? Galaxies colliding?

Just me...

[hank]

Here's an example of what I have in mind... Go to the nearest (or farthest)
black hole you can think of, and show me what cool things it does. Jets?
Material being sucked into the center mass? Galaxies colliding?

Just me...

Wow. I'd like to see your CEL script for that.

- Hank

[maxim]

I never managed to find out why this resemblance was so close. There is nowhere any reference neither to Maple nor to Lua. ...

http://www.lua.org/manual/
http://www.math.uic.edu/maple/labs/

hope that helps.

maxim


BTW, do you know how to write the 'hello world' program in any possible programming language (including lua and mable of course)?
-> http://en.wikipedia.org/wiki/Hello_world_program

You want to do it in a more esoteric prog language, such as 'Argh!, 'Borg', 'NULL', 'Ook!' or 'T'? No problem:
-> http://www.reference.com/browse/wiki/Hello_world_program_in_esoteric_languages

Example?

Code: Select all

 DNA / Genetic code

The following code should theoretically translate to the peptide HELLQWQRLD, (cross fingers).

    TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

[BrainDead]

Wow. I'd like to see your CEL script for that.

Are you saying that I cannot do this in CEL?

[t00fri]

I never managed to find out why this resemblance was so close. There is nowhere any reference neither to Maple nor to Lua. ...

http://www.lua.org/manual/
http://www.math.uic.edu/maple/labs/

hope that helps.

maxim

But as far as I am aware there is NO cross-reference to either Lua in the Maple manual or Maple in the Lua documentation.

Did you find any? Of course, being so extremely familiar with the Maple syntax that I don't look into their manuals anymore since > 10 years at least, the cross-reference in principle may still lurk somewhere...

Bye Fridger

[hank]

I never managed to find out why this resemblance was so close. There is nowhere any reference neither to Maple nor to Lua. ...

From a brief look at the Maple docs, I think the resemblance is probably coincidental. Despite some superficial similarities, the languages are actually quite different in both syntax and semantics. The similarities are likely due to a common source in mathematical notation and earlier programming languages (e.g. Algol).

- Hank

[t00fri]

I never managed to find out why this resemblance was so close. There is nowhere any reference neither to Maple nor to Lua. ...

From a brief look at the Maple docs, I think the resemblance is probably coincidental. Despite some superficial similarities, the languages are actually quite different in both syntax and semantics. The similarities are likely due to a common source in mathematical notation and earlier programming languages (e.g. Algol).

- Hank

Let's hope so...Inded I spoke Algol, a long long time ago.
Besides studying physics, I also made a bachelor in numerical math and informatics at a University that was instrumental in creating Algol as a computer language...

For our younger friends, Algol was sort of a predecessor of Pascal, with Pascal being virtually unknown to anybody below 20

Bye Fridger

[maxim]

But as far as I am aware there is NO cross-reference to either Lua in the Maple manual or Maple in the Lua documentation.

Did you find any? Of course, being so extremely familiar with the Maple syntax that I don't look into their manuals anymore since > 10 years at least, the cross-reference in principle may still lurk somewhere...

There seems to be no direct relationship:

http://www.lua.org/history.html
http://www.scg.uwaterloo.ca/SCG/history.html

Exept that language designers (which all have a more or less identical background) desided to build a small, fast, simple and easy to use language for os independent use.


maxim

[cpotting]

But I still need some information on CELX, before starting my educational tour: is it worth for my needs?
I explain: CEL scripts allow me to stop, move, modify almost everything during the show., but CELX doesn't allow this, correct?
For my needs (shows for school boys aged 10-18, and for adults), when I receive a question, I need the possibility to stop, explain what they are asking for, show again, go closer or farther, speed-up or slow down, and so on.
If CELX makes this impossible, sorry, it's not for me.

Hi Andrea,

CELX does everything that CEL does plus more. I have not found any function that can be accomplished with CEL that can't be done in CELX.

That said, it may seem little harder to do the same thing in CELX. Why? Because CELX is intended to let you get a little closer to the inner workings of Celestia - it is not as "user-friendly". The syntax is a little more complicated. But the increased complexity is because you can do so much more...

For instance - the Guide (I'm sorry, I'm not trying to push it - it's just a good example). The Guide

presents menus,
accepts user input,
decides what to do based on the user input,
creates examples (with some randomness thrown in),
recognises which settings the user has turned on and which are turned off and adjusts the examples accordingly,
executes those examples,
remembers previous menus and keystrokes,
automatically adjusts for changes to the screen size,

and other things that CEL just can't do. And, it is all done in CELX.

This sounds to me to be exactly what you are asking for. With CELX it is not only possible to show your students a lesson. You can also control the lesson and add new abilities.

I have just completed a script to be used to show the comparitive size and orientations of any two objects (for instance, how large is Jupiter compared to Earth, or Barnard's Star compared to Mercury's orbit?). I don't think that something like this is even possible with CEL scripts (I can't think of how to do it). I would like to send you this script, with your permission, so you can see.

I actually created the script with you in mind - I thought it might be of use to you at your observatory. I was going to ask you to look it over and tell me if you think of improvements that I could make - so this would work out well.

[hank]

The Guide

presents menus,
accepts user input,
decides what to do based on the user input,
creates examples (with some randomness thrown in),
recognises which settings the user has turned on and which are turned off and adjusts the examples accordingly,
executes those examples,
remembers previous menus and keystrokes,
automatically adjusts for changes to the screen size,

and other things that CEL just can't do. And, it is all done in CELX.

Clive,

Is your CELX UI code packaged for general use?

- Hank

[danielj]

Well,why my message was ignored?
It is more than an year,that the Deep Space Tour is not updated.With a better presentation of DSOs,this could be considered.Don??t you think?
Actually,it had beem several months since no new script is created.I don??t know why.I am talking about a downloable script,not this cut and paste methods.
The last solar system script was Pluto Tour,I think and since then,no more updates have been available...